intron


Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for intron

sequence of a eukaryotic gene's DNA that is not translated into a protein

References in periodicals archive ?
Fusion of PML gene involving intron 3 of breakpoint cluster region (bcr) on chromosome 15 with intron 2 of RAR[alpha] gene on chromosome 17 leads to formation of bcr1 (long isoform).
Roivant Sciences, a company that in-licenses late-stage drug candidates and develops them through subsidiaries, has signed a global licensing agreement with Korea-based iNtRON Biotechnology for the treatment of infectious diseases caused by antibiotic-resistant staphylococci, it was reported yesterday.
Intron 2, 3, 9 and 10 are found altered at different seven loci.
The primer pair (Lep forward, GGCTTACTGCTGTGTGGTCT and rreverse, AATGGCCACGGTTCTACCTC) amplifying the 461 bp DNA fragment (containing the exon 2 and part of the intron 1 and intron 2) was designed using the Primer 3 (NCBI) program (accession AY495587).
- Intron Technology is a fast-growing automotive electronics solutions provider in China, which focuses on providing comphresenive solutions targeting critical automotive electronic components applied in new energy, body control, safety and powertrain systems with high entry barrier
A few mutations were detected more than once, that is, p.Gly607Arg in 4 alleles in 4 patients (all heterozygous), accounting for 3.3% (n =118), and p.Val1973* and the novel mutation c.5714+1G>C (intron 40) both found in 3 alleles in 2 patients each (1 heterozygous, 1 homozygous), each accounting for 2.45% (n =118).
The intron 3 VNTR variant in the XRCC4 gene showed an association with RA patients while no association was identified between the eNOS and RA.
In our study, we aimed to investigate whether polymorphisms of PPAR[gamma] (PPAR[gamma]2 Pro12Ala and exon 6 C161T) and PPAR[alpha] (intron 7 G2467C) are associated with or may affect serum fetuin-A levels in two cohorts.
This event occurred by the integration of the AluSx element in TSEN54 intron 8 (Figure 1).
By sequencing all the four products in all 221 patients (FET, FPD, and ET-PD) and 100 controls, no exonic variant was identified, while one exon-intron boundary variant (rs2241028) and one intron variant (rs2241027) were detected.
Among the many existing polymorphisms, some studies point out that genetic variants in the gene encoding nitric oxide synthase 3 (NOS3) -786T>C, 894G>T (Glu298Asp), and intron 4b/a may potentially explain the difference of declines characteristic of aging [19] and help to explain why some people demonstrate more benefits from physical training than others [18].
They differ structurally from other RNAs in that they are circularized by joining the 3' and 5' ends together via exon circularization or intron circularization [10].
Average Shannon entropy for each genomic feature [exon, intron, or untranslated region (UTR)] of HLA-A, HLA-B, and HLA-C was calculated by dividing the sum of Shannon entropy over the feature divided by the total length of the genomic feature.
Severe HA (sHA) is characterized by plasma levels of FVIII < 0.01 IU mL-1 (< 1% of normal levels) (2) and is commonly caused by the intron 22 inversion (frequency of approximately 45%) (3) or the intron 1 inversion (frequency of approximately 2%) (4) in the F8 gene; the rest of the causative mutations is greatly diverse.
The genomic DNA was amplified by PCR (polymerase chain reaction) using primers designed by EPIC approach (exon primed intron crossing) from cattle PRKAA2 gene sequence available at GenBank accession number AC_000160 (Table 1).