eubacterium


Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for eubacterium

References in periodicals archive ?
proteoclasticus TCCGGTGGTATGAGATGGGC Eubacterium ruminantium CTCCCGAGACTGAGGAAGCTTG Fibrobacter succinogenes GGTATGGGATGAGCTTGC GTTCGGAATTACTGGGCGTAAA GCGGGTAGCAAACAGGATTAGA Megasphaera elsdenii AGATGGGGACAACAGCTGGA GACCGAAACTGCGATGCTAGA Rumicoccus albus CCCTAAAAGCAGTCTTAGTTCG TGTTAACAGAGGGAAGCAAAGCA R.
Clinical and Microbiological Characteristics of Bacteremia Caused by Eggerthella, Paraeggerthella, and Eubacterium Species at a University Hospital in Taiwan from 2001 to 2010.
Faecalibacterium prausnitzii, Eubacterium rectale/Roseburia spp.
Purification and characterization of a highly thermostable glucose isomerase produced by the extremely thermophilic eubacterium Thermotoga maritima.
The similarity of 16S rRNA gene sequences is 99% and 94% respectively between this bacterium and Eubacterium limosum Butyribacterium methylotrophicum which can convert H2/CO2 into acetate through Acetyl-CoA pathway (Li et al.
2] y formato (Lachnospira multiparus, Ruminococcus albus y Ruminococcus flavefaciens), de butirato (Butyrivibrio fibrisolvens, Eubacterium cellulosolvens y Eubacterium rumininantium), de lactato (Lactobacillus ruminis, Lactobacillus vitulinus y Streptococcus bovis) y de amoniaco (Clostridium aminophilum, Clostridium sticklandii y Peptostreptococcus anaerobius) son susceptibles a los ionoforos, mientras que bacterias productoras de succinato y propionato (Anaerovibrio lipolytica, Fibrobacter succinogenes, Megasphaera elsdenii, Prevotella ruminicola, Selenomonas ruminantium, Succinimonas amylolytica y Succinivibrio dextrinosolvens) son resistentes (62).
4 Ademas, existe la presencia de bacterias como: Corynebacterium sp, Mycoplasma hominis, Proteus sp, Staphylococcus epidermidis, Atopobium sp, Peptococcussp, Peptostreptococcus sp, Clostridium sp, Bifidobacterium sp, Propionibacterium sp, Eubacterium sp, Bacteroides sp, Prevotella sp, entre otras.
Aunque no hay certeza de aislamientos en bacterias celuloliticas, se ha reportado la presencia de r/articulas viricas (desechos de faigos-cabezas y tallos solos) en Butirivibrio fibrisolvens (cepa AR14) y Ruminoccus flavefaciens (AR66), Bacteroides ruminicola y Eubacterium ruminantium, y material genetico viral en R.
were predominant with anaerobic Clostridium, Eubacterium, and Bifidobacterium making up the majority (12.
Further studies should include the use of Clostridium, Fusobacterium and Eubacterium, as well as several other microorganisms that produce butyric acid, which may also be implicated in the replication and reactivation of HIV-1.
Healthy people's feces were rich in Eubacterium, Roseburia and Bacteroides species.
En la flora intestinal normal encontramos los siguientes probioticos: Bacteroides, Eubacterium, Clostridium, Fusobacterium, Bifidobacterium, Lactobacillus, Peptococcus, Peptostreptococcus, Escherichia, y Veillonella.
The major anaerobic bacterial group, including Bacteroides, Clostridium, Bifidobacterium, Lactobacillus, and Eubacterium, was found 3-4 times lower in acute cholera and diarrhoea patients.
viscosus) y especies de eubacterium y fusubacterium.
Las bacterias resistentes a la amoxicilina fueron Fusobacterium necrophhorum, Bacteroides fragilis, Bacteroides ureoliticus, Eubacterium limosun y el Peptostreptococcus prevotii.