eubacteria


Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
Related to eubacteria: archaebacteria
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for eubacteria

References in periodicals archive ?
The plates were incubated at 30[degrees]C for 5 days for Actinomycetes, and at 37[degrees]C for 24 hours for Eubacteria 12.
Mitochondria and plastids originated from [alpha]-proteobacteria and cyanobacteria of eubacteria, respectively, and increased in number during evolution.
Partial 16S rRNA genes were amplified by PCR with a eubacteria primer set, F357 (57CCTACGGGAGGCAGCAG-3') and R518 (5'-ATTACCGCGGCTGCTGG-3').
The detection of the molecular marker present in the 23S rRNA gene of Gram-positive bacteria with HGC content allowed discrimination between strains of eubacteria and mycobacteria.
Very stable enzymes from extremely thermophilic archebacteria and eubacteria. Appl.
Based on this gene set, it is estimated that there are about 1000–1150 species of microbiota in the human gut.[sup][4] According to their functions in the human body, they are classified into three types: (1) symbiotic bacteria or probiotics, which are intestinal-dominant bacteria mainly composed of strict anaerobic bacteria such as lactic acid bacteria, bifidobacteria, bacteroides, eubacteria, and nitrobacteria.
number Gene probes Eubacteria 16S Euba-F TGGAGCATGTGGTTTAATTCGA X58308 rDNA Euba-R TGCGGGACTTAACCCAACA Euba-S TexTed-CACGAGCTGACGACARCCATGCA-BHQ2 Actinomyces 16S Act-F GGT CTC TGG GCC GTT ACT GA spp.
Regardless of the exact phylogeny of early life form, diversity has arisen out of evolutionary pressure and gives rise to the archaea and eubacteria. (8) With a common origin, endosymbiotic fusion (9) has been possible because the common language of replication and control has been shared in their RNA.
(2003), using the following oligonucleotide probes: EUB338-II-In (a mix of EUB338, EUB338(II) and EUB338(III)), to target most Eubacteria, including Verrucomicrobia and Planctomycetes (Amann et al., 1990; Daims et al., 1999) -being this probe useful as a control to analyze the hybridization percentage in relation to the total 4,6-diamidino-2-phenylindole (DAPI)-stained bacterial density-; ALF968, specific for Alphaproteobacteria (Amann & Fuchs, 2008); BET42a, to target Betapro-teobacteria (Manz et al., 1992); GAM42a, for Gammaproteobacteria (Manz et al., 1992); CF319a, to target Cytophaga (Manz et al., 1996), and HGC69a for Actinobacteria (Amann et al., 1995).
Sequencing of the amplicon were carried out using the same primers for PCR which were designed to amplify approximately 1.5 kbp region of the 16S rRNA in eubacteria. The raw sequence results of the 16S rDNA were obtained in ".abi" format were analysed and cleaned up using Dot Plot programme.
Kogut M (1991) The 'true' intracellular environment of moderately halophilic eubacteria. In 'General and applied aspects of halophilic microorganisms'.
This ancient protein family functions as water channels and is found in all kingdoms (including archaea, eubacteria, fungi, plants, and animals).
Coral mucus--a micro-layer of polysaccharides and glycoproteins deposited over the surfaces of these animals--has been found to contain representatives of the three primary domains Archaea, Eubacteria and Eukarya (Meikle et al., 1988; Wegley et al., 2007).