glycogen

(redirected from Glycogen phosphorylase)
Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
Related to Glycogen phosphorylase: glycogen synthase
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for glycogen

one form in which body fuel is stored

References in periodicals archive ?
The primer sequences for real-time quantitative polymerase chain reaction analysis Genes Primer sequences Product GeneBank (5'[right arrow]3') size (bp) Identification GAPDH F:GAGGGTAGTGAAGGCTGCTG 113 NM_204305 R:CATCAAAGGTGGAGGAATGG GLUT3 F:ATGCTCTTCCCCTATGCTGA 123 NM_205511 R:AAAAGTCCTGCCCTTGGTCT GLUT8 F:GCAAGGGGTGTATCAAGCAG 126 NM_204375 R:GGCAGAGAAGAGCCAGAATG PYG F:CTTTGGGATGAGGGTGGAG 105 NM_204392.1 R:ATCTGGTCAACTGCCTGCTT GYS2 F:ATCGCCTTCTGTCTCTCAGC 108 XM_015291547.1 R:TTTTGCCTATCCCTTTCAGC GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GLUT3, glucose transporter 3; GLUT8, glucose trans-porter 8; PYG, glycogen phosphorylase; GYS2, glycogen synthase.
Effects of eugenol-reduced clove extract on glycogen phosphorylase b and the development of diabetes in db/db mice.
No differences in glycogen synthase (p = 0.9), glycogen phosphorylase (p = 0.9), and glycogen-6-phosphatase (p = 0.7) were apparent between experimental groups (Figures 4(b)-4(d)).
Immunoenzymometric assay of human glycogen phosphorylase isoenzyme BB in diagnosis of ischemic myocardial injury.
Maslinic acid, a natural inhibitor of glycogen Phosphorylase, reduces cerebral ischemic injury in hyperglycemic rats by GLT-1 up-regulation.
Interestingly, cones express glycogen phosphorylase (Brennenstuhl et al., 2015), suggesting they may use glycogen as an alternative energy source.
The final product is ATP, which is a form of energy storage needed for cellular metabolism [10-15] This hypothesis would have two consequences on the one hand, degradation of glycogen phosphorylase activation or induction of glycogen as it is explained above, this reaction remained upstream of the cascade of biochemical reactions that lead to a complete glycolysis with the results in the formation of ATP, the other possible entry of glucose into hepatocytes through activation of glycogen synthase.
Swanson, "Temporal patterns of tissue glycogen, glucose, and glycogen phosphorylase activity prior to hibernation in freeze-tolerant chorus frogs, Pseudacris triseriata," Canadian Journal of Zoology, vol.
Glucose is cleaved from glycogen branches by the activated form of glycogen phosphorylase. Glycogen phosphorylase b is a stored, inactive form of the enzyme, and is activated to glycogen phosphorylase a to release glucose or phosphorylated glucose units from glycogen (Friedman 1985).
Glycogen phosphorylase is the primary enzyme involved in this breakdown and Aegle marmelos appears to inhibit glycogen phosphorylase, thereby regulating the glycogenolysis pathway and leading to a decrease in the glucose level in the blood (Narendhirakannan et al.
In the Iceland scallop Chlamys islandica, a decrease in the amount of glycogen in the adductor muscle reduced the number of binding sites for the key glycolytic enzyme glycogen phosphorylase, which may explain this scallop's lower activity levels (Brokordt & Guderley 2004a).
Galactosaemia, in fact, often results in hypoglycaemia caused by hepatic accumulation of galactose-1phosphate, which inhibits enzymes of glycogenolysis; including glucose-6-phosphatase, glucose-6-phosphate dehydrogenase, phosphoglucomutase and glycogen phosphorylase. The inadvertent administration of insulin to such affected neonates, in whom blood glucose is already dangerously low, obviously has the effect of lowering glucose levels further.
Expression of glycogen phosphorylase, responsible for glycogen catabolism was increased 4-fold by P4 when compared to controls (P<0.05).
Glycogen breakdown is mediated by glycogen phosphorylase. Glycogen is an immediate source of glucose for cardiac tissue to maintain its metabolic homeostasis [21].