nucleotide

(redirected from Deoxynucleotide triphosphate)
Also found in: Dictionary, Medical, Acronyms, Encyclopedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for nucleotide

References in periodicals archive ?
Incorporation or lack of incorporation of deoxynucleotide triphosphates (dNTPs) indicates the DNA sequence.
Cy5-labeled deoxynucleotide triphosphates were used to allow fluorescence detection of the extension products by use of a microarray system of spotted tag oligonucleotides complementary to signature tags on the extension primers.
Each reaction contained 5 [milcro]LL of formamide lysate preparation, 5 mM Mg[Cl.sub.2], 0.2 mM deoxynucleotide triphosphates, 67 mM Tris-HO, 16.6 mM [(N[H.sub.4]).sub.2]S[O.sub.4], 4.5 mL/L Triton X-100, 0.2 g/L gelatin, 0.5 [milcro]L of ROX reference dye (Life Technologies), 0.9 [micro]M each of the sense and antisense primers, 0.6 [micro]M each of the wild-type and mutant MGB probes, and 2.2 U of Tth plus.
The 25-[micro]L reaction mixture contained 1 x TagMan EZ Buffer, 3 mM manganese acetate, 0.3 mM each deoxynucleotide triphosphate (except 1.2 mM for dUTP), 0.25 U of AmpErase UNG, 2.5 U of rTth DNA polymerase, 0.8 [micro]M each primer, 0.4 [micro]M each probe, and 10 [micro]L of extracted RNA (4 [micro]L for the 1-probe assay).
Amplifications were carried out in 50 [micro]L with 10 mM Tris-HCl (pH 8.3), 50 mM KCI, 2 mM Mg[Cl.sub.2], 200 [micro]M each deoxynucleotide triphosphate, 0.5 [micro]M each primer, and 2.5 U of Sure Prime DNA polymerase (Q-Biogene).
The reaction mixture used in the PCR consisted of 40 ng of genomic DNA, 0.2 [micro]L of each primer (10 [micro]M), 1 [micro]L of the SimpleProbe (1.6 [micro]M), 5 U of Fast Start Taq Polymerase (Roche Diagnostics GmbH), 1.2 [micro]L of 25 mM Mg[Cl.sub.2], and 200 [micro]M each deoxynucleotide triphosphate (Roche Diagnostics).
Optimal PCR conditions for triplex amplification of factor V Leiden, factor II G20210A, and MTHFR C677T were as follows: 10 ng of pure genomic DNA, 10 pmol of each primer, 200 [micro]M each deoxynucleotide triphosphate (dNTP), 3 mM Mg[Cl.sub.2] and 0.5 U of HotGoldStar Taq polymerase (Eurogentec) in 20 [micro]L (final volume) of the buffer supplied (Eurogentec).
The 50-F.[micro]L reaction mixture contained 1.5 U of GeneAmp[R] rTth DNA Polymerase XL (Applied Biosystems), 1X XL Buffer II, 1.25 mM Mg(OAc)Z, 0.2 mM each deoxynucleotide triphosphate, 0.4 [micro]M each primer, and 20-100 ng of genomic DNA.
PCR reactions (50 [micro]L) contained 25 pmol of each primer (PPPIE2for, 5'-GACTCTTCAGGTTCAGACACGG-3'; PPPE2Irev, 5'CACGTACCTTGGCCACCAGG; PPPIE10/11for, 5'-CCGCAGGGAAGATCAG3'; PPPIE12rev, 5'-TCACCCGTCCTCCCAGG3'; PPPI12Cfor, 5'-ATTCGTGGAGCCGGCGTC3'; PPPI13Crev, 5'-CAGAGGGTGTCCGTGTGG-3'; all from MWG Biotech), 50 ng of DNA template, 1 U of Taq polymerase in the supplied PCR buffer (Promega) supplemented with 1.5 mM Mg[Cl.sub.2], and 2 nmol of each deoxynucleotide triphosphate. PCR conditions were 96[degrees]C for 2 min; 35 cycles of 96[degrees]C for 30 s, 30 s at 65[degrees]C (exon 2; 210 bp) or 60[degrees]C (exon 11-12; 300 bp), and 72[degrees]C for 30 s; followed by 5 min at 72[degrees]C.
Each 50-[micro]L PCR reaction contained 0.2 [micro]M each primer, 200 [micro]M each deoxynucleotide triphosphate, 1x Q solution (Qiagen), and 1 U of HotStarTaq DNA polymerase in 1x supplied PCR buffer (Qiagen).