Cajanus cajan


Also found in: Dictionary, Encyclopedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for Cajanus cajan

tropical woody herb with showy yellow flowers and flat pods

References in periodicals archive ?
Experiencias previas muestran que, el follaje de quinchoncho (Cajanus cajan) puede ser utilizado como banco de proteina o ingrediente de suplementos en la dieta de rumiantes [16, 18, 24], ya que ofrece abundante produccion de biomasa (forraje/corte = 40 TM MV/ha) y niveles altos de proteina, tanto del grano como del follaje, sugieren su uso como leguminosa, con gran potencial para ser utilizadas para la alimentacion de rumiantes [14, 25].
The pigeon pea ( Cajanus cajan (L.) Millsp.) is tolerant to water deficit, can be helpful in recovering degraded areas and in soil fertility maintenance (Azevedo et al., 2007; Singh et al., 2013), being also used as a cover crop (Suzuki & Alves, 2006).
Phytophthora cajani, a new species causing stem blight on Cajanus cajan. Mycologia, 1978; 70(1): 171-176.
A world list of chickpea (Cicer arietinum L.) and pigeon pea (Cajanus cajan L.) Mill sp.) Pathogens.
Antioxidative parameters in the seedlings of pigeonpea (Cajanus cajan (L.) Millspaugh) in response to Zn and Ni stresses.
The tumor necrosis factor alpha (TNF-[alpha]) and interleukin 1 beta (IL-1[beta]) inhibitory activities of Cajanus cajan (leaves) crude methanolic extract, its fractions and its phytochemical constituents were evaluated in lipopolysaccharide (LPS) stimulated RAW 264.7 and J774A.1 cells.
PCR primers were designed based on the complete sequence of the defensin gene from six legumes available in the GenBank database (Cicer arietinum [DQ288897], Trigonella foenum-graecum [AY182163], Medicago sativa [AF319468], Arachis diogoi [AY288448], Cajanus cajan [AY244556], Tephrosia villosa [AY907349]), CtDefF(GGATCCATGGCAAT AAAATTT AGCCCA) and CtDefR (GAATTCTCAACAATCAAAGTAACAGAAGCA).
cribraria was obtained on kudzu, soybean and pigeon pea, Cajanus cajan (L.) Millsp.; (Fabales; Fabaceae).