C. trachomatis


Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for C. trachomatis

bacteria responsible for the sexually transmitted diseases chlamydia and lymphogranuloma venereum

Related Words

References in periodicals archive ?
pneumoniae is generally considered susceptible to antibiotics interfering with prokaryotic DNA, RNA, or protein synthesis, such as quinolones, tetracyclines, and macrolides, but in contrast to C.
WGS confirmed LGV (ompA sequence identical to those of the C.
Agentes clamidiales transmitidos por contacto directo (infecciones genitales y oculares de C.
Serum samples from all clients were collected to determine IgM antibody to C.
A traves de un metodo inmunoenzimatico indirecto (ELISA) comercial (Bioline[R]) se determinaron los anticuerpos IgM e IgG anti C.
According to an initial analysis, the test showed a specificity and sensitivity of 100% and 83%, respectively, when used simultaneously with Swiss Roche's (VTX:ROG) Cobas Amplicor C.
The KL1 (5'TCCGGAGCGAGTTACGAAGA3') and KL2 (3,AATCAATGCCCGGGATTGGT5') primers were used to amplify a 241 bp fragment of the C.
While doxycycline outperformed azithromycin in men with C.
The aim of the current work was to evaluate the relationship between either past or current C.
Diversos paises han adoptado programas de control epidemiologico para garantizar el diagnostico y tratamiento temprano de infecciones por C.
Polymerase chain reaction technology then was used to identify C.
Se empleo un sistema autoctono y economico de RCP anidada con control interno de la amplificacion para la deteccion de C.