C. psittaci


Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Synonyms for C. psittaci

bacteria responsible for the sexually transmitted disease chlamydia

Related Words

References in periodicals archive ?
RNA sequencing identified commensal bacteria in all samples, but C.
Since descriptions of infectious diseases in toucans and aracaris are lacking in veterinary literature, the proposal of this case report is to describe serological findings associated with the detection of C.
Among caged, nonpsittacine birds, infection with C.
trachomatis HSP60 can actually lead to inflammation and scarring in humans as C.
pneumoniae Cpn ompAF1 ATAGACCTAACCCGGCCTACAATAAG ompA ([dagger]) Cpn ompAR1 GTGAACCACTCTGCATCGTGTAA C.
Chlamydial antigen was detected by enzyme-linked immunosorbent assay from both cloacal and throat swabs, but cultures for C.
The ompA gene was detected in birds and humans by using a C.
The principal strategies for the elimination of psittacosis outbreaks among poultry workers are reducing C.
Reference ompA genotype sequences A-F and the ompA sequence of the C.
This finding is in contrast to our previous study of seabirds, in which we found a C.
Convalescent-phase serum was negative for other atypical pneumonia organisms, including adenovirus, C.
psittaci (Biomerieux, Nurtingen, Germany) showed high antibody titers against C.