bone

(redirected from Bone morphogenetic protein)
Also found in: Dictionary, Medical, Acronyms, Encyclopedia, Wikipedia.
Related to Bone morphogenetic protein: Bone morphogenetic protein 4, Bone morphogenetic protein 7
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • all
  • verb
  • noun
  • adj

Synonyms for bone

to study or work hard, especially when pressed for time

Synonyms

Synonyms for bone

rigid connective tissue that makes up the skeleton of vertebrates

the porous calcified substance from which bones are made

a shade of white the color of bleached bones

study intensively, as before an exam

consisting of or made up of bone

Related Words

References in periodicals archive ?
Bone morphogenetic protein and bone morphogenetic protein gene family in bone formation and repair.
Signal transduction of bone morphogenetic proteins in osteoblast differentiation.
Expression of mRNA encoding growth differentiation factor 9 and bone morphogenetic protein 15 during follicular formation and growth in a marsupial, the brushtail possum (Trichosurus vulpecula).
Expression of growth differentiation factor 9 (GDF9), and bone morphogenetic protein 15 (BMP-15), and BMP receptors in the ovaries of goats.
Abbreviations: A, osteoarthritis; AR, anti-resorptive fixed combinations of plant extracts; BF, bone formation fixed combinations of plant extracts; BMI, body mass index; BMP-2, bone morphogenetic protein 2; C, combination of all four plant extracts; DEXA, dual-energy x-ray absorptiometry; DM, diabetes miletus type 2; ETOH, ethanol; HC, hypercholesterolemia; HT, hypertension; RANKL, receptor activator of nuclear factor kappa-B ligand.
Tabrizian, "Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair--part A: current challenges in BMP delivery," Biotechnology Letters, vol.
The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4.
Highly prolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphogenetic protein IB re captor (ALK6) that is expressed in both oocytes and granulosa cells.
Abbreviations: BMP = bone morphogenetic protein, BV = bone volume, CNS = central nervous system, microCT = microcomputed tomography, H&E = hematoxylin and eosin, HO = heterotopic ossification, RNA = ribonucleic acid, RTPCR = reverse transcript polymerase chain reaction, SCI = spinal cord injury, T = thoracic, VA = Department of Veterans Affairs.
Methods for use of autologous fibroblasts for developing personalized biologics with bone morphogenetic protein 2 (BMP-2) for bone repair, opening the potential for optimal therapeutic effect of BMP-2 at the site of disease in surgical procedures involving bone repair; and
Single-nucleotide polymorphisms and haplotypes of bone morphogenetic protein genes and peripheral bone mineral density in young Korean men and women.
Each sample (2 [micro]L cDNA) was tested with real-time SYBR Green PCR reagent (Life Technologies) with specific primers: 18S (forward: AGTCCCTG CCCTTTGTACACA; reverse: CGAT CCGAGGGCCTCACTA), GAPDH (forward: TGGCACAGTCAAGGCTGAGA; reverse: CTTCTGAGTGGCAGTGATGG), bone morphogenetic protein 2 (Bmp2) (forward: AAGC CAT C G AG G AACT TT CA GA; reverse: TCAC AGGA AATTTTGA GCTGGC), and osteocalcin (OCN): (forward: TCTGACAAAGCCTTCATGTCCA; reverse: AACGGTGGTGCCATAGAT).
Urine release of systemically administered bone morphogenetic protein hybrid molecule.
Solubilized and insolubilized bone morphogenetic protein.
Full browser ?