morphogenesis

(redirected from morphogenic)
Also found in: Dictionary, Medical, Encyclopedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Words related to morphogenesis

differentiation and growth of the structure of an organism (or a part of an organism)

References in periodicals archive ?
3,6,10) In the DBM-HA group, the osteoinductive (allograft) material induced bone formation because DBM contains bone morphogenic proteins that have the ability to induce new bone formation.
1 R: ACGCCGGTTCTTATCTATCGT F, forward; R, reverse; BAX, bcl-2 associated X protein; Bcl-2, B cell lymphoma-leukemia-2; BMP, bone morphogenic protein; PCNA, proliferating cell nuclear antigen; PHSD, P-hydroxysteroid dehydrogenase; CYP19A1, cytochrome P450 aromatase; CYP17A1, cytochrome P450 17a-hydroxylase; CYP11A1, cytochrome P450 cholesterol side-chain cleavage enzyme; StAR, steroidogenic acute regulatory protein; FSHR, follicle-stimulating hormone receptor; LHR, luteinizing hormone receptor; ER, estrogen receptor a.
Use of Bone Morphogenic Protein-7 as a Treatment for osteoarthritis.
Bone Morphogenic Proteins (BMP) and autologous bone grafts were placed in-between fragment ends in a sandwich-like manner to help augment inter-fragmental osteogenesis.
These include hydroxyapatite, tricalcium phosphate, and calcium sulfate, as well as other biologic agents such as bone morphogenic protein, -transforming growth factor, and platelet-derived growth factor (Brandi 2012).
Immunoblotting was performed using antibodies against transformation growth factor (TGF-[beta]) (Santa Cruz, USA), bone morphogenic protein 6 (BMP6) (Bioworld Technology, Inc.
As exemplified by blood product tracking on Spain's Balearic Islands, more than just equipment and people will be managed: blood products, neural implants, cardiac valves, bone morphogenic proteins, and tissue implants all have expiration dates and need to be stored at the correct temperature and humidity.
This disease occurs in approximately 1 in 100,000 people (4), and in 50% to 60% of the patients a germline mutation in SMAD4 (5) or bone morphogenic protein receptor 1A (BMPR1A) (6) genes can be found.
The repair device further contains a bioactive substance for stimulating cell growth such as plateletrich plasma, cartilage-derived morphogenic proteins, or recombinant human growth factors.
JUNE 2-3: MORPHOGENIC FIELD TECHNIQUE - Advanced Procedure Clinical Level with Dr.
Kovacevic and colleagues carried out a review in which they looked at their own results using bone morphogenic proteins (BMPs) and at other investigators' use of biological interventions, confirming improved healing and strength in the tendons of rats and sheep.
One of the biggest improvements we had was in bone morphogenic products," Meckley says.
So, bone morphogenic protein - which costs around pounds 1,000 per gram and helps the new bone grow into the body - could be added only to the outer layers where it's needed, saving cash.
Different physiological and morphogenic responses can also be observed through callus culture like somaclonal variations, somatic embryogenesis, organogenesis; it can also pave the way for isolating economically valuable phytochemicals, which can avoid the collection of plant materials from natural sources (Flick et al.
Table I: Percentage of the morphogenic induced responses in explants from immature Spilanthus acemella Murr leaves under different levels of 2,4-D and IAA after 6 weeks of culture .