glyceraldehyde


Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
Related to glyceraldehyde: acetone
  • noun

Synonyms for glyceraldehyde

a sweet crystalline aldehyde formed by the breakdown of sugars

Related Words

References in periodicals archive ?
MicroRNA genes were measured relative to U6 and other genes relative to the housekeeping gene for glyceraldehyde 3-phosphate dehydrogenase.
ADAMTS12 Forward AGTGGGCAACTGGAGTGAGT 67 bp product Reverse ACATGTGACACTGCGAATCC GAPDH Forward CCTGCACCACCAACTGCTTA 108 bp product Reverse TCTTCTGGGTGGCAGTGATG ADAMTS: A disintegrin-like and metalloproteinase with thrombospondin motifs; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase.
The PCR primers were as follows: TLR2, forward primer 5'-GGC TTC TCT GTC TTG TGA CC -3', reverse primer 5'-GGG CTT GAA CCA GGA AGA CG -3'; TLR4, forward primer 5'-TTG TAT TCA AGG TCT GGC TGG-3', reverse primer 5'-GCA ACC TTT GAA ACT CAA GCC -3'; TLR7, forward primer 5'-GAT AAC AAT GTC ACA GCC GTC C-3', reverse primer 5'-GTT CCT GGA GTT TGT TGA TGT TC -3'; TLR9, forward primer 5'-TAC CAA CAT CCT GAT GCT AGA CTC -3', reverse primer 5'-TAG GAC AAC AGC AGA TAC TCC AGG -3'; glyceraldehyde 3-phosphate dehydrogenase (GAPDH), forward primer 5'-GAA GGT GAA GGT CGG AGT C-3', reverse primer 5'-GAA GAT GGT GAT GGG ATT TC-3'.
Glyceraldehyde has been proposed as an antiglycolytic preservative for whole blood.
Then NADPH donates its proton and removes the phosphate group from 1,3-bisphosphoglycerate to create glyceraldehyde 3-phosphate (G-3-P or PGAL).
The complementary DNA was generated from 100 ng of total RNA with random hexamer primers using a Gene-Amp RNA polymerase chain reaction (PCR) kit (Perkin Elmer, Foster City, Calif) and was amplified by reverse transcriptase (RT)-PCR using glyceraldehyde phosphate dehydrogenase (GAPDH) primers with AmpliTag DNA polymerase (Perkin Elmer).
The membranes were blocked with either 50 g/L skim milk (Merck Chemicals) (for analysis of FUS and GFP) or 50 g/L BSA (Sigma-Aldrich) [for analysis of glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] prepared in TBS-T buffer (50 mmol/L Tris-HCl, pH 6.
The increase in glycolysis can activate glyceraldehyde 3 phosphate dehydrogenase which gets translocated to the nucleus after polyadenylation.
Other related applications claim cellobiohydrolases and glyceraldehyde phosphate dehydrogenases.