glut


Also found in: Dictionary, Medical, Legal, Financial, Acronyms, Idioms, Encyclopedia, Wikipedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • all
  • noun
  • verb

Synonyms for glut

Synonyms for glut

to satisfy to the full or to excess

an amount or quantity beyond what is needed, desired, or appropriate

Synonyms for glut

the quality of being so overabundant that prices fall

supply with an excess of

References in periodicals archive ?
Importantly, these GLUT inhibitors were well tolerated and reduced inflammation in mouse models at therapeutically relevant doses.
8 million barrels per day, thus the glut would have expanded by 1.
Over its long history of operation, the actions of the Glut Cooperative have anticipated several of the more recent narratives of economic, social and environmental sustainability-what some refer to as the "three-legged stool of sustainability.
Hardness values of Gly/Glut, Gly/Glut + CP, Gly/ Glut + CP + 1 g R, Gly/Glut + CP + 2 g R, Gly/ Glut + CP + 3 g R were also evaluated.
The key findings of our study suggest that monetary policy and the global saving glut are statistically correlated with residential development and increased financial innovation.
Experimental primer sequence and length primer sequence GLUT, F 5'- CAATTTCATCATCGCCCTCT-3' GLUT, R 5'- TGCAGCAATTTCGTCAAAAG-3' [beta]-actin F 5'- TAAAGACCTCTATGCCAACACAGT -3' [beta]-actin R 5'- CACGATGGAGGGGCCGGACTCATC -3' primer location length GLUT, F 1365-1384 20 base pairs GLUT, R 1518-1499 20 base pairs [beta]-actin F 1188-1165 24 base pairs [beta]-actin R 948-971 24 base pairs Table 2.
In tomorrow's Scottish Cup there could also be a goal glut as Celtic take on Hibs hoping to secure a domestic double.
Glut is a director/writer of low-budget independent motion pictures (mostly low-budget/campy/sexy horror films, most recently Blood Scarab; author of approximately 70 books (novels including a national best-seller The Empire Strikes Back and non-fiction, e.
Dichas biomoleculas transportadoras pertenecen a un grupo constituido por dos familias de proteinas: la familia de los GLUT (Facilitador del Transporte de Glucosa) y la familia de los SGLT (Transportador de glucosa acoplado a Na+) (Barrett et al.
It is likely to take the form of an opaque global credit glut, turbocharged by the fragile mixture of too-big-to-fail global banking with a huge and largely unwatched and unregulated shadow banking sector.
5 per cent year-on-year in June, the lowest rate in more than 12 months, an auto industry association said Friday, increasing fears that rapidly expanding production could lead to a glut in the.
There is a mounting glut of LNG on both sides of Suez, not only due to a global recession which has hit the world hard since mid-2008 but also because of supplies from so many new liquefaction plants out-stripping demand which has shrunk.
Global Sugar Glut to End By 2008-09: The current global sugar glut is likely to end by the next marketing year ending October 2009 on strong ethanol demand and a fall in sugar output, Leonardo Dichara Rocha, an economist with the International Sugar Organization said at an industry conference recently.
This, of course, means a glut of unneeded migrant workers--if our federal legislators allow them to remain in this country, with President Bush providing them a fast track to eventual citizenship.
The month of January finds markets for some secondary plastics slowing in light of reduced buying from Chinese interests and a glut of material.