pyrimidine

(redirected from Pyrimidine nucleotides)
Also found in: Dictionary, Medical, Encyclopedia.
Related to Pyrimidine nucleotides: Adenine nucleotides
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Words related to pyrimidine

any of several basic compounds derived from pyrimidine

a heterocyclic organic compound with a penetrating odor

Related Words

References in periodicals archive ?
PCR primer pairs used in this study * Primer Gene Genome name name Product name coordinates Orientation RdRp ORF 1b Nsp12-pp1ab 15146-15164 Sense primer (RdRp) 15213-15233 Antisense Nsp14 ORF 1b Nsp14-pp1ab 19113-19138 Sense primer (nuclease ExoN 19225-19249 Antisense homolog) Primer Product name length (bpSequence (5' to >3') RdRp 88 TAAGTTTTATGGCGGCTGG# primer TTTAGGATAGTCCCAACCCAT# Nsp14 137 TGTTTGTTTTGGAATTGTAATGTTGA# primer TGGAATGCATGCTTATTAACATACA# Note: 5' propynyl-modified pyrimidine nucleotides are shown in #.
In addition to de novo synthesis, pyrimidine nucleotides can also be synthesized via salvage of the pyrimidine nucleosides uridine and cytidine.
There is an increasing awareness that pyrimidine nucleotides synthesized via the de novo pathway play an important role in a variety of biological processes (1).
Patients with myoadenylate deaminase deficiency and patients with pyrimidine-5'-nucleotidase deficiency have no characteristic metabolite profile in body fluids, although increased concentrations of pyrimidine nucleotides have been demonstrated in erythrocytes with [sup.