endonuclease

(redirected from Endonucleases)
Also found in: Dictionary, Medical, Encyclopedia.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Words related to endonuclease

a nuclease that cleaves nucleic acids at interior bonds and so produces fragments of various sizes

References in periodicals archive ?
Type II contain only one endonuclease, cas9 that makes it simple and easy to use (32).
To examine whether TALEN could be used for the targeted cleavage of endogenous Sall1 in porcine fibroblasts, genomic DNA isolated from fibroblasts transfected with the TALEN expression vector was treated with T7 endonuclease I, which specifically cleaves heteroduplexes formed by the hybridization of wild-type and mutant DNA sequences.
The results obtained with the use of endonucleases Hinc II, Acc I, and PflM I showed that the cutting sites were identical to FV3 in 100% (10/10) of the isolates from the current study.
Lipskaia LA (1994) [Calcium and magnesium ion-dependent endonuclease 37 kDa is activated during colchicine-induced apoptosis in HL-60 cells].
To put his gene theory into practice, all Burt and his colleagues had to do was reengineer a homing endonuclease to cut a certain spot in a mosquito's genome.
The sence of 465 bp fragment of HBX gene in pcDNA3 was verified by restriction endonucleases digestion, colony PCR and DNA direct sequencing (Figure 1).
The crystal structure of the nuclease domain of colicin E7 suggests a mechanism for binding to double-stranded DNA by the H-N-H endonucleases.
Plasmid DNA was isolated from an overnight bacterial culture and cut with restriction endonucleases which found on the map of cloning vector.
Performing separate digestions of PCR products with different endonucleases, all samples collected from different regions of Turkey showed identical restriction profiles with each enzyme used (Fig.
Microbiologist and geneticist Werner Arber shared the Nobel Prize in Physiology or Medicine with Hamilton Smith and Daniel Nathans for the discovery of restriction endonucleases, which recognise sequences in DNA.
This approach is more sensitive then pDNA using profiling with non frequent or rare cutter endonucleases but less sensitive then DNA sequencing.
The primers 5EGbrcx (sense) 5' GGGGATCCGCCCAGGCCTCCACGCTCA 3' and 3EGbrcx (anti-sense) 5' GGCTCGAGCTGCCGGTA CCGCTGGAAGA 3', which contain recognition target for the restriction endonucleases BamHI and XhoI, respectively, were used to amplify the gene in L.
BACKGROUND: DNA methylation analysis currently requires complex multistep procedures based on bisulfite conversion of unmethylated cytosines or on methylation-sensitive endonucleases.
Mathematical model for studying genetic variation in terms of restriction endonucleases.
Isolation and Evaluation of endonucleases in apoptotic activity of DNA in Ischemic Injury and Reperfusion injury of rat Hepatocyts.