References in periodicals archive ?
Two new hybrid Dendroica warblers and new methodology for inferring parental species.
An intergeneric wood-warbler hybrid (Mniotilta varia x Dendroica coronata) and use of multilocus DNA analyses to diagnose avian hybrid origins.
Hylocichla) I Turdus migratorius 11 Ixoreus naevius Chamaea fasciata 2 Bombycilla cedrorum 2 Dendroica sp.
5 Black-throated-green Warbler, Dendroica virens Vegetation 9 Chestnut-sided Warbler, Dendroica pensylvanica Vegetation 9 Golden-winged Warbler, Vertnivora chrysoptera Vegetation 8.
For example, in North American wood-warblers (Parulidae) of the genus Setophaga (including all former Dendroica and Parula taxa as well as Wilsonia citrina; Chesser et al.
The conservation management of Kirtland's Warbler Dendroica kirtlandii.
4] R: GCCGATGTAGACAAAGAAAG Primer name Top level of success Dpu01 (a) Genotyping Dpu16 (a) None Dca24 (h) None Dca28 (b) Genotyping VeCr01 (c) Genotyping VeCr02 (c) Genotyping VeCr03 (c) PCR VeCr04 (c) PCR VeCr05 (c) PCR VeCr06 (c) Genotyping VeCr07 (c) Genotyping VeCr10 (c) PCR VeCr11 (c) Genotyping * VeCr14 (c) Genotyping VeCr16 (c) Genotyping (a) Dendroica petechia-Dawson et al.
longspurs elevated to Calcariidae, Oporornis [in part] to Geothlypis, split of Troglodytes troglodytes to Pacific and Winter Wren) affect several accounts, although some readers may still enjoy seeing Dendroica in print.
australis) Bird Crane, whooping Grus americana Curlew, Eskimo Numenius borealis Falcon, American peregrine Falco peregrinus anatum Murrelet, marbled Brachyramphus marmoratus marmoratus Owl, northern spotted Strix occidentalis caurina Plover, piping Charadrius melodus Tern, roseate Sterna dougallii dougallii Warbler, Kirtland's Dendroica kirtlandii Reptile Turtle, leatherback sea Dermochelys coriacea Clam/Mussel Riffleshell, northern Epioblasma torulosa rangiana Wedgemussel, dwarf Alasmidonta heterodon Fish Cisco, blackfin Coregonus nigripinnis Sturgeon, short, nose Acipenser brevirostrum Sturgeon, white (Kootenai River Acipenser transmontanus pop.
Las poblaciones de chipe (reinita, Dendroica chrysoparia) son pequenas, estan en aparente disminucion, y limitadas a reproduccion en el habitat de encino-junipero (roble-enebro) del centro de Texas, un habitat amenazado por la urbanizacion y pastoreo de ganado.