Cajanus


Also found in: Dictionary, Wikipedia.
Related to Cajanus: Cajanus cajan
  • noun

Synonyms for Cajanus

References in periodicals archive ?
Alleviation of salt-induced ionic, osmotic and oxidative stresses in Cajanus cajan nodules by AM inoculation.
vehicle (10% Tween 80), test group received CCE (50, 100 and 400mg/kg), pinostrobin (10 and 20mg/kg) and cajanus lactone (10 and 20mg/kg) and a positive control group received dexamethasone (5mg/kg) respectively at an interval of 12 h.
In an article published by CAJANUS, the prevalence rate of diabetes mellitus affecting Jamaicans is higher than in North American and "many European countries"(Callender 2000).
PCR primers were designed based on the complete sequence of the defensin gene from six legumes available in the GenBank database (Cicer arietinum [DQ288897], Trigonella foenum-graecum [AY182163], Medicago sativa [AF319468], Arachis diogoi [AY288448], Cajanus cajan [AY244556], Tephrosia villosa [AY907349]), CtDefF(GGATCCATGGCAAT AAAATTT AGCCCA) and CtDefR (GAATTCTCAACAATCAAAGTAACAGAAGCA).
MEAN NUMBER OF DAYS ([+ or -] SE) FOR EACH DEVELOPMENTAL STAGE OF RASTROCOCCUS ICERYOIDES REARED ON SIX HOST PLANT SPECIES (CUCURBITA MOSCHATA, MANGIFERA INDICA, PARKINSONIA ACULEATA, CAJANUS CAJAN, FICUS BENJAMINA, AND COFFEA ARABICA).
Plant species that showed the concentration values of phosphorus greater than 500mg/100g were leaves of Cleome gynandra, Acalypha bipartitae, Hyptis spicigera, Amaranthus graecizans, Solanum nigrum, Asystasia gangetica, seeds of Cajanus cajan, Corchorus olitorius and fruits of Cucumis figarei and Ficus sur (Table 4).
Biological ageing means a greater likelihood for people to seek health care and this concurs with other studies (Bourne, McGrowder & Nevins, in print; Bourne 2009; Brown et al 2008; Erber 2005; Brannon & Fiest 2004; Costa 2002; Buzina 1999; CAJANUS 1999; Anthony 1999) as the reasons are linked to increased biological conditions.
Smillie and Hetherington (1983) verified that plants with decreasing degrees of adaptation to cold, such as Pisum sativum, Cajanus cajan, Triticum aestivian, Arachis hypogea, pennisetum sp.
Effect of zinc on free radicals and proline in brassica and cajanus.
The plant species which are tested for host range are Cajanus cajan, Capsicum annuum, Chenopodium amaranticolor, Cicer arietinum, Cucumis sativus, Cucurbita pepo, Glycine max, Lycopersicon esculentum, Nicotiana glutinosa, N.
Sangronis E and CJ Machado Influence of Germination on the Nutritional Quality of Phaseolus vulgaris and Cajanus cajan.