Cajun

(redirected from Cajan)
Also found in: Dictionary.
Graphic Thesaurus  🔍
Display ON
Animation ON
Legend
Synonym
Antonym
Related
  • noun

Words related to Cajun

a Louisianian descended from Acadian immigrants from Nova Scotia ('Cajun' comes from 'Acadian')

Related Words

References in periodicals archive ?
2] and ethanol extracts from Cajanus cajan against were determined against eight microorganisms.
Physiological basis of salt stress resistance in pigeonpea (Cajanus cajan L.
The plant species which are tested for host range are Cajanus cajan, Capsicum annuum, Chenopodium amaranticolor, Cicer arietinum, Cucumis sativus, Cucurbita pepo, Glycine max, Lycopersicon esculentum, Nicotiana glutinosa, N.
Sangronis E and CJ Machado Influence of Germination on the Nutritional Quality of Phaseolus vulgaris and Cajanus cajan.
Smillie and Hetherington (1983) verified that plants with decreasing degrees of adaptation to cold, such as Pisum sativum, Cajanus cajan, Triticum aestivian, Arachis hypogea, pennisetum sp.
14] 14 George L & Eapen S, Organogenesis and embryogenesis from diverse explants of pigeon pea (Cajanus cajan L.
PCR primers were designed based on the complete sequence of the defensin gene from six legumes available in the GenBank database (Cicer arietinum [DQ288897], Trigonella foenum-graecum [AY182163], Medicago sativa [AF319468], Arachis diogoi [AY288448], Cajanus cajan [AY244556], Tephrosia villosa [AY907349]), CtDefF(GGATCCATGGCAAT AAAATTT AGCCCA) and CtDefR (GAATTCTCAACAATCAAAGTAACAGAAGCA).
Plant species that showed the concentration values of phosphorus greater than 500mg/100g were leaves of Cleome gynandra, Acalypha bipartitae, Hyptis spicigera, Amaranthus graecizans, Solanum nigrum, Asystasia gangetica, seeds of Cajanus cajan, Corchorus olitorius and fruits of Cucumis figarei and Ficus sur (Table 4).
Leguminous shrub species consisted of Cajanus cajan, Cratylia argentea, Gliricidia sepium, Leucaena leucocephala and Stylosanthes guianensis and non-leguminous shrub species were Annona senegalensis, Moringa oleifera, Securinega virosa and Vitellaria paradoxa.