C. psittaci


Also found in: Dictionary, Medical, Encyclopedia, Wikipedia.
  • noun

Synonyms for C. psittaci

bacteria responsible for the sexually transmitted disease chlamydia

Related Words

References in periodicals archive ?
RNA sequencing identified commensal bacteria in all samples, but C.
trachomatis HSP60 can actually lead to inflammation and scarring in humans as C.
pneumoniae Cpn ompAF1 ATAGACCTAACCCGGCCTACAATAAG ompA ([dagger]) Cpn ompAR1 GTGAACCACTCTGCATCGTGTAA C.
The ompA gene was detected in birds and humans by using a C.
Reference ompA genotype sequences A-F and the ompA sequence of the C.
This finding is in contrast to our previous study of seabirds, in which we found a C.
Convalescent-phase serum was negative for other atypical pneumonia organisms, including adenovirus, C.